Thursday, September 8, 2016

Analogy/Homology Blog Post

For this homework, I will examine the common traits between Echidnas and Platypus.

1. Homologus traits
a. I believe the homologus traits shared between the echidnas and the playtupus is quite prominent. Echidnas are mole like animals with spines and a long snout that they use to tear through anthills to eat ants. Platypus are semi-aquatic egg laying mammals that also resemble a mole except for the duck bill they use to dig around in pond floors for food.
b. As I stated previously, both the platypus and the echidna species resemble moles in some form. Although platypus have bills and webbed feet and a beaver like tail, they are covered in dense, broad brown fur just like echidnas.  Also, the females of both species have poisonous spurs on their hind feet for protection and they are the only mammals to be capable of laying eggs. As for they're appearances, they don't look too similar. Platypus have the for mentioned bill, beaver tail and webbed feet while echidnas have long snouts, small bodies and spines like a porcupine. Besides that, both of these species share many common traits but have diverged in their evolutionary lines. Echidnas are not capable of hunting or diving while swimming and are mostly land dwellers, platypus do not have long snouts to use to eat insects buried in the ground or spines to protect themselves from predators.
c.  The Teinolophos and Steropodon species were the main ancestry of the echidna and platypus species. They were semi-aquatic mammals just like the platypus and also had a few characteristics like echidnas. So, in the echidnas evolutionary line, they most have lost the ability to dive in the water some time after the Quaternary period.
d. Image result for echidna ancestors

2. Analogous traits
a. Echidnas and platypus do have a common ancestry and may have separated during evolution, but they also exhibit common analogous traits that their species developed over time due to their environments.
b. What is a safer environment for something as small and defenseless as mole to live in? Underground, where predators will have a hard time finding the little animal. Echidnas and platypus follow the same strategy like moles. Echidnas use their claws to burrow in the ground for shelter and scavenge for food while doing so. They mostly live in dry environments and in desperate matters, they sometimes steal other animals burrows such as rabbits. Platypus also make burrows but they make them closer by to river banks for their benefits and hid themselves under roots.
c. The Teinolophos was an ancient platypus that passed on most of it's physical and genetic traits to the modern platypus. They may have been semi-aquatic animals, but they also had a link to echidnas as well. So they knew how to burrow and hide themselves from predators and most have lived on land and hunted in water like it's successors. Unfortunately, I was not able to get more information about this creature since there isn't a lot of background behind it because it is a creature that existed millions of years ago. This was the most I could get for it.
d. Image result for echidna burrow
Image result for platypus burrow pictures

Thursday, September 1, 2016

For the Protein Synthesis blog post homework, here is my DNA code: TACCAAGTCACGTGCAATACTGAACGTAACGTCAAATCTATC