Human Variation Blog post

Anthropology 101

1. Cold weather can be harmful and deadly. When a person goes out in freezing temperatures, they put themselves at risk of catching hypothermia and frostbite. Hypothermia is an illness where the individual's core body temperature is lower than 95 degrees F. Sufferers begin to shiver and have mental confusions due to lack of body heat and if not treated, it can cause the heart to stop beating. Frostbite is a condition where skin exposed to cold temperatures, freeze over and grow patchy and numb. In major cases, the exposed skin freezes completely and all sensory from that part of the body is cut off. This leads to body parts such as fingers and toes to have to be amputated for the better of the individual. 

2. Developmental adaptation

 It's been studied that people from colder climates have bigger body masses than those that live in warmer climates. This is due to the fact that in cold weather, an individual needs more energy to keep warm and having a bigger body helps with that. With a bigger body, individuals have more back-up sources to keep them going and use in emergency survival situations. 

Cultural adaptation

 Drinking or eating warm foods and beverages is a cultural way of fending off freezing weather. It warms the individuals body up and keeps them protected inside. Having warm foods won't help protect the outer side of the body, but it is a common method in cultures like America that help warm up the body. 

Facultative adaptation

 The winter season isn't everybody's favorite season since people usually get runny noses or colds during the period. But there is a secret effect that colder climates have on people that prevent them from getting infectious diseases such as malaria and sleeping sickness. Since our bodies are working more to keep us warm and well, the cold air pushes our bodies harder and increases the cells that prevent us from harmful viruses. Instead of making us sicker, the cold weather is actually making us stronger and more resilient. 

Short-term adaptation

In colder weather, there is a tendency for us to want to go to the bathroom more often. This occurrence happens because our bodies are trying to pump more blood in and it builds pressure in our kidneys. To reduce the pressure, our bodies respond by disposing of excess water, which is turned into urine and exits out the body. 

3. I believe that studying other cultures is a helpful thing for us. The great thing about understanding different cultures is how we can learn from them and maybe absorb some of their traditions into ours. It is a common practice in America that brings people closer. And becomes beneficial to our society. One of the benefits of going against the cold that our culture learned about was the amount of body weight the groups living in colder areas had. This informed us about the importance of good eating and it is advised that during the winter, that we need to eat better to conserve body heat. 

4. I can study the cultures of other races that live in harsh, cold weather and see differences in the way we deal with the cold and how they endure it. A sample of this is the Eskimo culture. Their villages are located in cold climates and they are used to living in it. Unlike people in warmer climates like Americans living in California, they have developed a resistance to the cold both through genotypic and phenotypic traits. Although it is possible to study humans through race, it shouldn't be the main way to understand them. Instead, we should observe the way they live, behave and communicate to learn about them. Studying human variations like this gives us better knowledge of how people from other countries and cultures can be similar to each other but at the same time different when it comes to adapting to their environments and how they evolve from it. 

Language Assignment Experiment blog post for Anthropology 101

Part 1: Question 1 - Thoroughly describe your own experiences and the responses of your partners to the experiment. Did you find this assignment easy or difficult and why? Did your partners alter the way they communicated with you because of your absence of communication? Answer - This experiment was difficult for me to do. For fifteen minutes, I had to keep a conversation with my brother about a topic that we both enjoy: gaming. I told my brother about the experiment and asked if he wanted to assist. He agreed and we began the conversation. When we started the discussion, I already didn't know how to talk to my brother through body language. It reminded me a lot of charades and I was never very good at it, but I was good at reading body language rather than doing it myself. So I tried to look at the situation from my brother's point of view. If I wanted to convey that I enjoyed something, I tried to make an expression that showed I was happy like smiling and clapping, if I wanted to express that I was disappointed in something, I tried to look sad and grumpy. It was hard though to get a full conversation through body language alone. You cannot simply say "What did you think about this?" without actually saying it to your discussion partner because it can't be conveyed through body language. Which was the problem with this experiment. If I wanted to ask my brother a question, I had to express it through my body and that couldn't be done. Also, the pace of our conversation was slow and there was a lot of guessing on my brother's part. Most of the time, he was trying to guess everything I wanted to say. If I was talking to him normally, our conversation wouldn't have felt that long and I could have been straight forward talking to my brother without him trying to guess everything.

Question 2 - Who was in control of the conversation, you or your partner? Who initiated or changed topics? Who asked and who answered questions? If you conducted this experiment with more than one person, were you ever excluded from the conversation? If you think of a conversation as a balance of power between two (or more) individuals, who had the power in this conversation, you or your partner? Explain your answer. Answer - My brother was definitely in charge of the conversation. He was the main person talking, guessing and changing the topics. Since I couldn't properly transition and have a full discussion with him, he took charge. If he asked me a question and I couldn't convey the answer properly, he would change the topic. I think he took charge because of how we were struggling to talk to one another. He was able to speak and I wasn't so he tried everything he could to make it easier for me to talk to him and for him to understand me.

Question 3 - Imagine that you and your partners in the conversation represent two different cultures, one that uses spoken language and one that doesn’t. Which culture has the advantage in communicating complex ideas within their population? What attitudes might the speaking culture have toward the culture that does not use symbolic language? Can you identify any modern situations that mirror or resemble this relationship between a culture that can speak and culture that can’t? Answer - Spoken language is dominant over symbolic language. Although I do believe that looking at a person's body language can tell an observer how that person is feeling, it cannot tell what a person's thoughts and opinions are. My brother could tell through my face that I was happy, sad, angry etc. But when he asked about my opinions on something, I could not truly express the answer through my face and body.  I grew up knowing how to express myself through speech and writing and that truly showed when those two forms of communication were taken away from me.

Part 2: Question 1 - Thoroughly describe your own experiences and the responses of your partners to the experiment. Did you find this assignment easy or difficult and why? How did your partner(s) respond to your lack of body language? Did they have any difficulty understanding you? Describe. Answer - This experiment was less difficult than the first, but it was still hard to perform. By taking away my ability of expression and emotion, my humanity was constrained by a flat, emotionless shell. I could not smile, I could not move my hands, head and other body parts. I also could not change the tone of my voice, so I spoke in monotone the whole time. I felt like a robot when I was talking to my sister and her reactions to my behavior was saddening to me. We were having a conversation about anime and what we liked most about it. My sister is always happy to talk about anime and likes to go on and on about and so do I. However, I couldn't express that passion in our conversation. My sister wanted to talk about characters that we loved most in our favorite shows and I tried to talk about that but she just stared at me while I was talking. Looking from my sister's perspective, it was like she was talking to a wall rather than a person. Since I couldn't change the expression on my face and couldn't move my body at all, my sister was not able to tell easily if what I was saying was true or not.

Question 2 - What does this experiment say about our use of “signs” in our language, i.e., how important is nonspeech language techniques in our ability to communicate effectively? What type of information do humans receive about the words a person is speaking when they “read” a person’s body language? Answer - This experiment taught me how expressive humans are when we communicate. No matter what form of communication we use, the most universal way we can all talk to one another is through emotions. From birth, we are taught about our emotions and what you can understand from them. Speech and words are the second form of communication we are taught after emotions and they are just as important for us humans to know about. I do think that languages are restrictive because, for example, English speakers understand other English speakers. If the English speaker doesn't know other languages and tries to talk to a Russian speaker, he won't understand him. The only way humans can understand others that are not of their native country, would have to understand their language.

Question 3 - Describe the adaptive benefit to possessing the ability to read body language. How might the ability to read body language help a person survive, obtain resources, and reproduce successfully? Answer -
Understanding a person's body language is essential to us because it can help us approach people properly. Say that one of my friends was upset about a recent breakup that happened recently between her and a boyfriend. What would I do as a friend? Ignore her evident sadness and joke around or ask her what's wrong and understand her situation. If I wanted her to grow angry at me, I would have ignored her feelings. But being a good friend that I am, I would ask her questions and comfort her through her breakup.

Question 4 -  Are there people who have difficulty reading body language and can you identify them? Can you describe a situation where there might be a benefit to not reading someone’s body language, i.e., a situation where perhaps body language does not give you reliable information? Answer - I would say that it was me that had some problems understanding body language. When I was in elementary school, my parents had me attend "special" private classes during school where I and a couple of other kids are given further education on speech and reading other peoples' body languages. It was nice and it showed how caring my parents were of me. They didn't want me to have problems as an adult and those classes did help build my relationships better with my friends and my awareness towards their feelings. I believe now that watching a person's body language is the easiest way to understand a person without talking to them, but saying it's easy for everybody is not being very honest. It was not easy for me and it is not easy for other people. Performing both of these experiments was not such a simple task but it did teach me several things of the importance of expressive communication either by spoken language or symbolic language.

Analogy/Homology Blog Post

For this homework, I will examine the common traits between Echidnas and Platypus.

1. Homologus traits
a. I believe the homologus traits shared between the echidnas and the playtupus is quite prominent. Echidnas are mole like animals with spines and a long snout that they use to tear through anthills to eat ants. Platypus are semi-aquatic egg laying mammals that also resemble a mole except for the duck bill they use to dig around in pond floors for food.
b. As I stated previously, both the platypus and the echidna species resemble moles in some form. Although platypus have bills and webbed feet and a beaver like tail, they are covered in dense, broad brown fur just like echidnas.  Also, the females of both species have poisonous spurs on their hind feet for protection and they are the only mammals to be capable of laying eggs. As for they're appearances, they don't look too similar. Platypus have the for mentioned bill, beaver tail and webbed feet while echidnas have long snouts, small bodies and spines like a porcupine. Besides that, both of these species share many common traits but have diverged in their evolutionary lines. Echidnas are not capable of hunting or diving while swimming and are mostly land dwellers, platypus do not have long snouts to use to eat insects buried in the ground or spines to protect themselves from predators.
c.  The Teinolophos and Steropodon species were the main ancestry of the echidna and platypus species. They were semi-aquatic mammals just like the platypus and also had a few characteristics like echidnas. So, in the echidnas evolutionary line, they most have lost the ability to dive in the water some time after the Quaternary period.
d. 

2. Analogous traits
a. Echidnas and platypus do have a common ancestry and may have separated during evolution, but they also exhibit common analogous traits that their species developed over time due to their environments.
b. What is a safer environment for something as small and defenseless as mole to live in? Underground, where predators will have a hard time finding the little animal. Echidnas and platypus follow the same strategy like moles. Echidnas use their claws to burrow in the ground for shelter and scavenge for food while doing so. They mostly live in dry environments and in desperate matters, they sometimes steal other animals burrows such as rabbits. Platypus also make burrows but they make them closer by to river banks for their benefits and hid themselves under roots.
c. The Teinolophos was an ancient platypus that passed on most of it's physical and genetic traits to the modern platypus. They may have been semi-aquatic animals, but they also had a link to echidnas as well. So they knew how to burrow and hide themselves from predators and most have lived on land and hunted in water like it's successors. Unfortunately, I was not able to get more information about this creature since there isn't a lot of background behind it because it is a creature that existed millions of years ago. This was the most I could get for it.
d. 

For the Protein Synthesis blog post homework, here is my DNA code: TACCAAGTCACGTGCAATACTGAACGTAACGTCAAATCTATC

For my anthropology class homework, I have chosen Charles Lyell as my main topic because of his research on geology and how it gave a positive influence on Charles Darwin's study of evolution. 

Sir Charles Lyell, was a Scottish geologist who grew up in the Grampian Mountains as a child. His father was a naturalist who had a huge stock of books that contained many subjects he studied, including geology. During Charles childhood, his fascination with the study of earth was quite prominent by the way he disliked school and decided to skip it and go to the New Forest. Charles was viewed as a strange boy by many people in the village he lived in, but that would prove to be a misjudgment once Charles furthers his studies in his adulthood. Since Charles was never deterred to stop his studies, he pursued his passion with the help of

others such as Naturalists Alexander von Humboldt and Georges Cuvier. Around this time, "Charles was

rapidly developing new principles of reasoning in geology and began to plan a book which would stress that there are natural (as opposed to supernatural) explanations for all geologic phenomena," (https://www.britannica.com/biography/Sir-Charles-Lyell-Baronet) so he decided to travel to countries such as Italy and France to prove his theories. Once he traveled to Mt. Etna, he finally discovered that his theories were correct. From the results of his trip, Charles returns from his trip and began to write his book, Principles of Geology, that discussed many principles, facts, studies and inquiries of his studies. This novel caught the attention and admiration of Charles Darwin himself and led to him using it for reference for his own studies when he traveled around the world. 

I believe that Sir Charles Lyell had a great influence on Charles Darwin because of Darwin's main studies: evolution. Darwin had to travel to many different locations to perform his studies and some of the destinations he went to were uncharted and potentially dangerous for him. Through Sir Charles Lyell's book, Principles of Geology, Darwin was capable to learn about geology and it greatly helped him on his travels. He even equipped the book with him whenever he decided to set out on a journey along with other materials. Without Lyell's studies, it would be possible that Darwin could have had a lot of problems charting unknown islands. 

If it wasn't for Lyell's geology proficiency and social circle, I think Charles Darwin might not have actually been willing to do too much traveling of his own since he lacked the skills of exploration. It would have made traveling difficult for him and it would have hindered his studies of evolution since many creatures live in very distant and treacherous locations. Since Darwin's main method of studying evolution was learning about an animal's origin of life such as their habitat, Lyell's book was of great use to him. However, as for Darwin's studies in evolution, Lyell didn't have much influence on that and even if Principles of Geology and the friendship both Charles would develop, Darwin would have been fascinated with the study of evolution since that interest sparked when he traveled on the HMS Beagle. The only possible influence that Lyell may have on Darwin in terms of the study of evolution, Lyell did introduce Darwin to Richard Owen, who was an anatomical. 

Darwin's theories of evolution disturbed many in the church because it opposed their religious beliefs. The thought of evolving from primitive beings was unheard of during Darwin's time and it baffled many. And such beliefs of evolution still baffle people today. Darwin was bold enough to publish his work to the public since Christianity was a huge part of human culture and many people believed in it. So once Darwin released his book, their would be many people that would be enraged by his accusations. Although Darwin's work was unsurprisingly despised by many, it was a wise decision on his part to release his findings to the public because of the impact it made on society. With the findings of evolution shown to the public, the book is able to make an impact on others and open their eyes to new concepts to humanity's mysterious upbringing. 

Sources:   https://www.britannica.com/biography/Sir-Charles-Lyell-Baronet

http://www.macroevolution.net/charles-lyell.html

https://www.britannica.com/biography/Charles-Darwin/The-private-man-and-the-public-debate